Stem-loop sequence ptr-mir-1253

AccessionMI0008458 (change log)
DescriptionPan troglodytes miR-1253 stem-loop
Gene family MIPF0000611; mir-1253
Stem-loop
   a  --ag  a    ua      a    a a                gaug   a 
5'  gc    ca gaga  gaaucc aaag g agaagaucagccugca    ugg c
    ||    || ||||  |||||| |||| | ||||||||||||||||    |||  
3'  cg    gu uucu  cuuagg uuuc c ucuucuagucggacgu    auc u
   c  aaga  a    --      g    c c                --aa   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr17: 2808442-2808545 [-]
sense
ENSPTRT00000068894 ; ptr-mir-1253-201; exon 1
Database links

Mature sequence ptr-miR-1253

Accession MIMAT0007978
Sequence

24 - 

agagaagaagaucagccugca

 - 44

Get sequence
Evidence by similarity; MI0006387
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).