Stem-loop sequence ptr-mir-1244-8

AccessionMI0008447 (change log)
DescriptionPan troglodytes miR-1244-8 stem-loop
Gene family MIPF0000569; mir-1244
Stem-loop
   --------       uccga   uu    ua    uuuugc   u    uu 
5'         aucuuau     gca  ccag  acuu      gua guac  a
           |||||||     |||  ||||  ||||      ||| ||||   
3'         uagagua     ugu  gguu  ugaa      uau caug  g
   aaaauugg       -----   uu    ga    ------   -    uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr9: 18549092-18549175 [+]
intergenic
Database links

Mature sequence ptr-miR-1244

Accession MIMAT0007970
Sequence

55 - 

aaguaguugguuuguaugagaugguu

 - 80

Get sequence
Evidence by similarity; MI0006379
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).