Stem-loop sequence ptr-mir-1244-3

AccessionMI0008442 (change log)
DescriptionPan troglodytes miR-1244-3 stem-loop
Gene family MIPF0000569; mir-1244
Stem-loop
   -----uc    uc  a   uu    ua   uuuuug    u    uu 
5'        uuau  cg gca  ccag  acu      ugua guac  a
          ||||  || |||  ||||  |||      |||| ||||   
3'        ggua  gu ugu  gguu  uga      auau caug  g
   aaaaauu    ga  a   uu    ga   ------    -    uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr12: 49743898-49743981 [+]
intergenic
Database links

Mature sequence ptr-miR-1244

Accession MIMAT0007970
Sequence

54 - 

aaguaguugguuuguaugagaugguu

 - 79

Get sequence
Evidence by similarity; MI0006379
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).