Stem-loop sequence ptr-mir-1185-1

AccessionMI0008419 (change log)
DescriptionPan troglodytes miR-1185-1 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   -       u    -     ga a              a  uga 
5'  uugguac ugaa gagag  u cccuuuguauguuc cu   u
    ||||||| |||| |||||  | |||||||||||||| ||    
3'  aacuaug guuu uucuc  a gggggacauauaag gg   u
   a       c    a     ag -              c  uaa 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr14: 86291220-86291304 [+]
sense
ENSPTRT00000068513 ; ptr-mir-1185-1-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-1185-1
ptr-mir-495chr14: 86282275-86282355 [+]
ptr-mir-376cchr14: 86287939-86288003 [+]
ptr-mir-376a-2chr14: 86288317-86288395 [+]
ptr-mir-654chr14: 86288467-86288546 [+]
ptr-mir-376bchr14: 86288684-86288782 [+]
ptr-mir-376a-1chr14: 86289030-86289096 [+]
ptr-mir-300chr14: 86289611-86289692 [+]
ptr-mir-1185-1chr14: 86291220-86291304 [+]
ptr-mir-1185-2chr14: 86292441-86292525 [+]
ptr-mir-381chr14: 86294164-86294237 [+]
ptr-mir-487bchr14: 86294699-86294781 [+]
ptr-mir-539chr14: 86295556-86295632 [+]
ptr-mir-889chr14: 86296136-86296213 [+]
ptr-mir-544chr14: 86296887-86296976 [+]
ptr-mir-655chr14: 86297767-86297874 [+]
ptr-mir-487achr14: 86300680-86300758 [+]
Database links

Mature sequence ptr-miR-1185

Accession MIMAT0007953
Sequence

14 - 

agaggauacccuuuguauguu

 - 34

Get sequence
Evidence by similarity; MI0003821
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).