Stem-loop sequence ptr-mir-1184-1

AccessionMI0008418 (change log)
Previous IDsptr-mir-1184
DescriptionPan troglodytes miR-1184-1 stem-loop
Gene family MIPF0000592; mir-1184
Stem-loop
   c ug a   c    ugaa      g   ---c    ca    ucaaca    cca 
5'  u  c gaa gagg    ggaggu guu    ugcu  gcag      gugg   c
    |  | ||| ||||    |||||| |||    ||||  ||||      ||||    
3'  g  g cuu uucc    ccuucg uag    gcga  cguc      cacc   a
   - gu -   -    ugug      g   uuca    --    ------    ucu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chrX: 154415568-154415665 [-]
sense
ENSPTRT00000076212 ; ptr-mir-1184-201; exon 1
ENSPTRT00000049704 ; F8-201; intron 22
antisense
ENSPTRT00000054835 ; ptr-mir-1184-201; 3'UTR (exon 1)
Database links

Mature sequence ptr-miR-1184

Accession MIMAT0007952
Sequence

61 - 

ccugcagcgacuugauggcuucc

 - 83

Get sequence
Evidence by similarity; MI0006277

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).