Stem-loop sequence ptr-mir-1182

AccessionMI0008416 (change log)
DescriptionPan troglodytes miR-1182 stem-loop
Gene family MIPF0000673; mir-1182
Stem-loop
   g  a   g   cu  cu   u c      u    cagc    gga       g 
5'  gg cuu uca  gc  guc c ucccuc ccag    gacu   uucugga u
    || ||| |||  ||  ||| | |||||| ||||    ||||   ||||||| c
3'  cc gaa ggu  ug  cag g agggag gguu    cugg   gagaucu c
   -  -   g   --  -u   u u      -    ----    ---       a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr1: 210030464-210030559 [-]
sense
ENSPTRT00000068719 ; ptr-mir-1182-201; exon 1
ENSPTRT00000003850 ; ptr-mir-1182-201; 3'UTR (exon 2)
Database links

Mature sequence ptr-miR-1182

Accession MIMAT0007950
Sequence

62 - 

gagggucuugggagggaugugac

 - 84

Get sequence
Evidence by similarity; MI0006275
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).