Stem-loop sequence ptr-mir-101-2

AccessionMI0008408 (change log)
DescriptionPan troglodytes miR-101-2 stem-loop
Gene family MIPF0000046; mir-101
Stem-loop
   - ug  c                    c a    guaua 
5'  c  uc uuuuucgguuaucaugguac g ugcu     u
    |  || |||||||||||||||||||| | ||||      
3'  g  gg aagaagucaauagugucaug c augg     c
   u gu  u                    a -    aaagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr9: 4889298-4889375 [+]
sense
ENSPTRT00000054453 ; ptr-mir-101-2-201; exon 1
ENSPTRT00000038388 ; RCL1-201; intron 8
Database links

Mature sequence ptr-miR-101

Accession MIMAT0002430
Sequence

48 - 

uacaguacugugauaacugaag

 - 69

Get sequence
Evidence by similarity; MI0000739
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).