Stem-loop sequence ptr-let-7e

Accession MI0008403
Description Pan troglodytes let-7e stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-cc   cu   g                u  ----gga  a 
   ggg  gag uaggagguuguauagu ga       gg c
   |||  ||| |||||||||||||||| ||       ||  
   ccc  uuc auccuccggcauauca cu       cc a
gga   cu   g                -  agaggaa  c 
Get sequence
Genome context
Coordinates (PanTro2.1.4) Overlapping transcripts
19: 56580917-56580994 [+]
sense
Clustered miRNAs
< 10kb from ptr-let-7e
ptr-mir-99b 19: 56580743-56580811 [+]
ptr-let-7e 19: 56580917-56580994 [+]
ptr-mir-125a 19: 56581386-56581470 [+]
Database links

Mature sequence ptr-let-7e

Accession MIMAT0007940
Sequence

7 - 

ugagguaggagguuguauaguu

 - 28

Get sequence
Evidence by similarity; MI0000066

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).