Stem-loop sequence ptr-let-7a-2

Accession MI0008398
Description Pan troglodytes let-7a-2 stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
a  uu   g   u             uagaa ua a 
 gg  gag uag agguuguauaguu     u  c u
 ||  ||| ||| |||||||||||||     |  | c
 cc  uuc auc uccgacaugucaa     a  g a
-  -u   g   c             --uag gg a 
Get sequence
Genome context
Coordinates (PanTro2.1.4) Overlapping transcripts
11: 120103182-120103252 [-]
sense
Clustered miRNAs
< 10kb from ptr-let-7a-2
ptr-mir-100 11: 120108878-120108957 [-]
ptr-let-7a-2 11: 120103182-120103252 [-]
Database links

Mature sequence ptr-let-7a

Accession MIMAT0007936
Sequence

5 - 

ugagguaguagguuguauaguu

 - 26

Get sequence
Evidence by similarity; MI0000060

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).