Stem-loop sequence xla-mir-194

Accession MI0008379
Description Xenopus laevis miR-194 stem-loop
Gene family MIPF0000055; mir-194
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-194_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-194 microRNA precursor is a small non-coding RNA gene that regulated gene expression. Its expression has been verified in mouse (MI0000236, MI0000733) and in human (MI0000488, MI0000732). mir-194 appears to be a vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000055). The mature microRNA is processed from the longer hairpin precursor by the Dicer enzyme. In this case, the mature sequence is excised from the 5' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
uagu  g       u         a      g    cuug 
    gu uaucggg guaacagca cuccau ugga    u
    || ||||||| ||||||||| |||||| ||||     
    ua guaguuu cauugucgu gaggug accu    c
--ac  g       u         a      -    uuuc 
Get sequence

Mature sequence xla-miR-194

Accession MIMAT0011141
Sequence

15 - 

uguaacagcaacuccaugugga

 - 36

Get sequence
Evidence by similarity; MI0004857

References

1
" Biasci D, Giudetti G, Barsacchi G, Andreazzoli M Unpublished (2008).