Stem-loop sequence sly-MIR395b

Accession

MI0008370

Description

Solanum lycopersicum miR395b stem-loop

Gene family

MIPF0000016; MIR395

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-395_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

mir-395 is a non-coding RNA called a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-395 is thought to target mRNAs coding for ATP sulphurylases. The mature sequence is excised from the 3' arm of the hairpin. miR-395 is upregulated in Arabidopsis during sulphate-limited conditions, when the mature miRNA then regulates sulphur transporters and ATP sulphurylases.

Stem-loop

u      guu   ua         ug c       ug  g    a  uug 
 uaaggu   ccc  gaguucccu  a cacuuca  ag gcuu cu   a
 ||||||   |||  |||||||||  | |||||||  || |||| ||    
 auuuca   ggg  cucaagggg  u gugaagu  uu cgaa ga   u
a      guu   uc         gu u       cg  g    -  uug 

Genome context

• Coordinates (SL2.40): SL2.40ch05: 1713691-1713791 [+]
• Overlapping transcripts:

  intergenic

Mature sequence sly-miR395b

• Accession: MIMAT0007927
• Sequence: 66 - cugaaguguuugggggaacucc - 87
• Evidence: experimental; 454 [1]

References

1. PMID:18653800 "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening" Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T Genome Res. 18:1602-1609(2008).
2. PMID:18602455 "Identification of conserved microRNAs and their targets from Solanum lycopersicum Mill" Zhang J, Zeng R, Chen J, Liu X, Liao Q Gene. 423:1-7(2008).