Stem-loop sequence sly-MIR171c

AccessionMI0008367 (change log)
DescriptionSolanum lycopersicum miR171c stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

24 open access papers mention sly-MIR171c
(131 sentences)

Stem-loop
      --au    --gaa      a                   g      c  u        a 
5' caa    ggau     uacacg gauauuggugcgguucaau agaaag ag acuuaaga c
   |||    ||||     |||||| ||||||||||||||||||| |||||| || ||||||||  
3' guu    ucua     augugc cuauaaccgcgccgaguua uuuuuc uc ugaguuuu a
      gauu    aaucg      a                   g      a  -        u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr12: 519779-519899 [-]
intergenic
Database links

Mature sequence sly-miR171c

Accession MIMAT0007924
Sequence

22 - 

uauuggugcgguucaaugaga

 - 42

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18653800 "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening" Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T Genome Res. 18:1602-1609(2008).