Stem-loop sequence sly-MIR171b

AccessionMI0008366 (change log)
DescriptionSolanum lycopersicum miR171b stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

22 open access papers mention sly-MIR171b
(176 sentences)

Stem-loop
      a        ug             a    cac    uua 
5' acg gauauugg  cgguucaauuaga agcg   uucu   u
   ||| ||||||||  ||||||||||||| ||||   ||||    
3' ugc cuauaacc  gccgaguuaauuu uugc   aaga   a
      a        gu             a    uuc    uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr2: 44783518-44783603 [-]
intergenic
Database links

Mature sequence sly-miR171b-5p

Accession MIMAT0037334
Sequence

6 - 

auauuggugcgguucaauuag

 - 26

Get sequence
Evidence experimental; Illumina [2]

Mature sequence sly-miR171b-3p

Accession MIMAT0007923
Sequence

65 - 

uugagccgugccaauaucacg

 - 85

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18653800 "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening" Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T Genome Res. 18:1602-1609(2008).
2