Stem-loop sequence sly-MIR171a

AccessionMI0008365 (change log)
DescriptionSolanum lycopersicum miR171a stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

23 open access papers mention sly-MIR171a
(150 sentences)

Stem-loop
   u    c  u    uu         c       c      ----   -     gua      au 
5'  gaaa ag aacu  gauauuggc ugguuca ucagac    aac aaaau   aacuau  u
    |||| || ||||  ||||||||| ||||||| ||||||    ||| |||||   ||||||   
3'  cuuu uc uuga  cuauaaccg gccgagu aguuug    uug uuuug   uuggua  u
   a    c  u    cu         u       u      cuuu   c     -ag      ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr2: 46752782-46752903 [-]
intergenic
Database links

Mature sequence sly-miR171a

Accession MIMAT0007922
Sequence

87 - 

ugauugagccgugccaauauc

 - 107

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18653800 "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening" Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T Genome Res. 18:1602-1609(2008).
2
PMID:18602455 "Identification of conserved microRNAs and their targets from Solanum lycopersicum Mill" Zhang J, Zeng R, Chen J, Liu X, Liao Q Gene. 423:1-7(2008).