Stem-loop sequence sly-MIR169d

AccessionMI0008364 (change log)
DescriptionSolanum lycopersicum miR169d stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

16 open access papers mention sly-MIR169d
(45 sentences)

Stem-loop
        -               --    a      uauuua       a               -u   uu     u   guuuaa    a 
5' gaaga gggguuuuauaugaa  guug gaguau      guagcca ggaugacuugccuac  uca  ugaua aua      aaua u
   ||||| |||||||||||||||  |||| ||||||      ||||||| |||||||||||||||  |||  ||||| |||      ||||  
3' cuucu uuccagaauguacuu  uaau cucgua      uaucggu ccuauugaacggaug  ggu  acugu uau      uuau a
        a               uu    g      caguuc       -               cu   uu     u   -aacag    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr7: 2171588-2171763 [-]
intergenic
Clustered miRNAs
< 10kb from sly-MIR169d
sly-MIR169bchr7: 2174563-2174767 [+]
sly-MIR169dchr7: 2171588-2171763 [-]
Database links

Mature sequence sly-miR169d

Accession MIMAT0007921
Sequence

39 - 

uagccaaggaugacuugccua

 - 59

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18653800 "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening" Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T Genome Res. 18:1602-1609(2008).