Stem-loop sequence sly-MIR169c

AccessionMI0008363 (change log)
DescriptionSolanum lycopersicum miR169c stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

17 open access papers mention sly-MIR169c
(48 sentences)

Stem-loop
        g      a         g   u             c                    g    ug a  c 
5' gucua agaguu uuguaugaa agg agggaguggagug agccaaggaugacuugccga augu  u gc u
   ||||| |||||| ||||||||| ||| ||||||||||||| |||||||||||||||||||| ||||  | || a
3' cagau uuucaa aauguacuu ucc ucucuuauuuuac ucgguuucuacuggacggcu uaca  a cg a
        a      -         a   -             a                    a    gu a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr7: 4210774-4210920 [+]
intergenic
Database links

Mature sequence sly-miR169c

Accession MIMAT0007920
Sequence

41 - 

cagccaaggaugacuugccga

 - 61

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18653800 "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening" Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T Genome Res. 18:1602-1609(2008).