Stem-loop sequence sly-MIR169b

AccessionMI0008362 (change log)
DescriptionSolanum lycopersicum miR169b stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

18 open access papers mention sly-MIR169b
(48 sentences)

Stem-loop
   u     -uu    uu      -   -            uugacau         uu      a    a       aaaauagaaguuuuagucaucguuaaaau 
5'  uuuaa   uggu  caggca guc uccuuggcuacc       gcucuuuuc  uuaugc agau ucuuuuc                             a
    |||||   ||||  |||||| ||| ||||||||||||       |||||||||  |||||| |||| |||||||                              
3'  aaguu   gcca  guccgu cag aggaaccgaugg       ugagaagag  aguacg ucug agagaag                             u
   a     cau    -c      u   u            uuuauuc         -u      a    a       aaaauuuauucugaacauuggggcagagc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr7: 2174563-2174767 [+]
intergenic
Clustered miRNAs
< 10kb from sly-MIR169b
sly-MIR169dchr7: 2171588-2171763 [-]
sly-MIR169bchr7: 2174563-2174767 [+]
Database links

Mature sequence sly-miR169b

Accession MIMAT0007919
Sequence

171 - 

uagccaaggaugacuugccug

 - 191

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18653800 "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening" Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T Genome Res. 18:1602-1609(2008).