Stem-loop sequence sly-MIR166b

Accession

MI0008359

Description

Solanum lycopersicum miR166b stem-loop

Gene family

MIPF0000004; MIR166

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-166_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The plant mir-166 microRNA precursor is a small non-coding RNA gene. This microRNA (miRNA) has now been predicted or experimentally confirmed in a wide range of plant species. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The mature products are thought to have regulatory roles through complementarity to messenger RNA.

Stem-loop

    a   aucaua       a  ucucu      a        uu      cu   g u   c   --ua   c          --a     -accaug     c 
uccc uag      uggagga gu     caguug ggggaaug  gucugg  cga g cac aau    gau cauaaucccu   uauau       cuuuu a
|||| |||      ||||||| ||     |||||| ||||||||  ||||||  ||| | ||| |||    ||| ||||||||||   |||||       ||||| a
aggg auc      aucuccu ca     guuaac ccccuuac  cggacc  gcu u gug uug    cua guauugggga   guaua       gaaaa a
    g   -----g       -  ---uu      c        uu      ag   g u   a   ugua   a          aaa     auauuua     a 

Genome context

• Coordinates (SL2.40): SL2.40ch08: 62860593-62860793 [+]
• Overlapping transcripts:

  intergenic

Mature sequence sly-miR166b

• Accession: MIMAT0007916
• Sequence: 154 - ucggaccaggcuucauucccc - 174
• Evidence: experimental; 454 [1]

References

1. PMID:18653800 "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening" Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T Genome Res. 18:1602-1609(2008).