Stem-loop sequence sly-MIR166a

AccessionMI0008358 (change log)
DescriptionSolanum lycopersicum miR166a stem-loop
Gene family MIPF0000004; MIR166
Literature search

26 open access papers mention sly-MIR166a
(104 sentences)

Stem-loop
          a     uc               u     aa  a g   a     uga 
5' guugagg gaaug  gucugguucgagauc uucau  ga a gua augaa   c
   ||||||| |||||  ||||||||||||||| |||||  || | ||| |||||   a
3' caacucc cuuac  cggaccaggcuuuag aagug  cu u uau uacuu   a
          c     uu               u     --  a g   a     uug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr6: 2516284-2516394 [-]
intergenic
Database links

Mature sequence sly-miR166a

Accession MIMAT0007915
Sequence

86 - 

ucggaccaggcuucauucccc

 - 106

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18653800 "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening" Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T Genome Res. 18:1602-1609(2008).