Stem-loop sequence bmo-mir-317

AccessionMI0008349 (change log)
DescriptionBombyx mori miR-317 stem-loop
Gene family MIPF0000144; mir-317
Literature search

8 open access papers mention bmo-mir-317
(14 sentences)

Stem-loop
         uc       c -        --      c  u   gaaaa 
5' gggcua  gaacgac g ggugccac  gcugug uc cuc     u
   ||||||  ||||||| | ||||||||  |||||| || |||     u
3' cuugau  cuuguug c cuauggug  cgacac ag gag     a
         cc       a u        gu      a  u   gcggu 
Get sequence
Deep sequencing
11807 reads, 1.73e+03 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581681.1: 3841495-3841586 [-]
intergenic
Database links

Mature sequence bmo-miR-317-5p

Accession MIMAT0015277
Previous IDsbmo-miR-317*
Sequence

16 - 

cgggugccacgcugugcucucu

 - 37

Get sequence
Deep sequencing23 reads, 3 experiments
Evidence experimental; Illumina [3]
Database links

Mature sequence bmo-miR-317-3p

Accession MIMAT0007906
Previous IDsbmo-miR-317
Sequence

53 - 

agugaacacagcuggugguauc

 - 74

Get sequence
Deep sequencing11784 reads, 3 experiments
Evidence experimental; cloned [2], Illumina [3]
Database links

References

1
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
2
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
3
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).