Stem-loop sequence bmo-mir-281

AccessionMI0008348 (change log)
DescriptionBombyx mori miR-281 stem-loop
Gene family MIPF0000087; mir-46
Literature search

6 open access papers mention bmo-mir-281
(17 sentences)

Stem-loop
         a           -ua     c      a  gc 
5' ucuguu augaagagagc   uccgu gacagu uu  u
   |||||| |||||||||||   ||||| |||||| ||  g
3' aggcaa uauuucucucg   aggua cuguca aa  a
         g           uug     -      c  au 
Get sequence
Deep sequencing
37756 reads, 6.27e+03 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582034.1: 1683515-1683591 [+]
intergenic
Database links

Mature sequence bmo-miR-281-5p

Accession MIMAT0007904
Previous IDsbmo-miR-281*
Sequence

11 - 

aagagagcuauccgucgacagu

 - 32

Get sequence
Deep sequencing37494 reads, 3 experiments
Evidence experimental; Northern [1], RT-PCR [2], Illumina [3]
Database links

Mature sequence bmo-miR-281-3p

Accession MIMAT0007905
Previous IDsbmo-miR-281
Sequence

46 - 

acugucauggaguugcucucuu

 - 67

Get sequence
Deep sequencing262 reads, 3 experiments
Evidence experimental; Northern [1], RT-PCR [2], Illumina [3]
Database links

References

1
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
2
3
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).