Stem-loop sequence bmo-mir-210

AccessionMI0008347
DescriptionBombyx mori miR-210 stem-loop
Gene family MIPF0000086; mir-210
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-210_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-210 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. mir-210 has been strongly linked with the hypoxia pathway, and is upregulated in response to Hypoxia-inducible factors. It is also overexpressed in cells affected by cardiac disease and tumours. MiRNA-210 in particular, has been studied for its effects in rescuing cardiac function after myocardial infarcts via the up-regulation of angiogenesis and inhibition of cardiomyocyte apoptosis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
           -  aaa   ---       gc   -         u  guca 
5' aaugaagu cc   gca   gcugcug  cac ugcacaaga ua    a
   |||||||| ||   |||   |||||||  ||| ||||||||| ||     
3' uuacuuua gg   cgu   cggcgac  gug gcguguucu au    g
           c  --g   uau       -a   u         c  auuu 
Get sequence
Deep sequencing
4 reads, 2.8 reads per million, 1 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SILKDB2.0) Overlapping transcripts
nscaf1898: 4464447-4464538 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-210
bmo-mir-210nscaf1898: 4464447-4464538 [+]
bmo-mir-3286nscaf1898: 4469305-4469424 [+]

Mature sequence bmo-miR-210

Accession MIMAT0007903
Sequence

56 - 

uugugcgugugacagcggcu

 - 75

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [2]

References

1
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).