Stem-loop sequence bmo-mir-210

AccessionMI0008347 (change log)
DescriptionBombyx mori miR-210 stem-loop
Gene family MIPF0000086; mir-210
Literature search

2 open access papers mention bmo-mir-210
(3 sentences)

Stem-loop
           -  aaa   ---       gc   -         u  guca 
5' aaugaagu cc   gca   gcugcug  cac ugcacaaga ua    a
   |||||||| ||   |||   |||||||  ||| ||||||||| ||     
3' uuacuuua gg   cgu   cggcgac  gug gcguguucu au    g
           c  --g   uau       -a   u         c  auuu 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582008.1: 4476417-4476508 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-210
bmo-mir-210NW_004582008.1: 4476417-4476508 [+]
bmo-mir-3286NW_004582008.1: 4481275-4481394 [+]
Database links

Mature sequence bmo-miR-210

Accession MIMAT0007903
Sequence

56 - 

uugugcgugugacagcggcu

 - 75

Get sequence
Deep sequencing6 reads, 1 experiments
Evidence experimental; Illumina [2]

References

1
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).