Stem-loop sequence bmo-mir-133

AccessionMI0008345 (change log)
DescriptionBombyx mori miR-133 stem-loop
Gene family MIPF0000029; mir-133
Literature search

8 open access papers mention bmo-mir-133
(15 sentences)

Stem-loop
   aaagcg      -u    c   u           cuuc  gu     u  cau 
5'       agagcg  uguu gcu uagcugguuga    gg  caaau gu   u
         ||||||  |||| ||| |||||||||||    ||  ||||| ||   u
3'       uuucgu  acaa uga gucgaccaacu    cc  guuua ua   u
   ------      cu    u   u           -ucc  ug     c  uac 
Get sequence
Deep sequencing
10 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582020.1: 5611904-5612004 [-]
intergenic
Database links

Mature sequence bmo-miR-133

Accession MIMAT0007901
Sequence

64 - 

uugguccccuucaaccagcugu

 - 85

Get sequence
Deep sequencing10 reads, 1 experiments
Evidence experimental; Illumina [2]

References

1
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).