Stem-loop sequence bmo-mir-13b

AccessionMI0008342 (change log)
DescriptionBombyx mori miR-13b stem-loop
Gene family MIPF0000049; mir-2
Literature search

5 open access papers mention bmo-mir-13b
(19 sentences)

Stem-loop
   guc         -     -             uc   u  c 
5'    cauggccca cucgu aaaaauggcugug  gug ag a
      ||||||||| ||||| |||||||||||||  ||| || a
3'    gugucgggu gagca uuuuuaccgacac  uac uc c
   --u         u     g             ua   -  c 
Get sequence
Deep sequencing
524 reads, 33.3 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582015.1: 7692288-7692367 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-13b
bmo-mir-2a-1NW_004582015.1: 7692561-7692650 [-]
bmo-mir-13aNW_004582015.1: 7692416-7692494 [-]
bmo-mir-13bNW_004582015.1: 7692288-7692367 [-]
bmo-mir-2a-2NW_004582015.1: 7692153-7692232 [-]
bmo-mir-2bNW_004582015.1: 7692030-7692105 [-]
Database links

Mature sequence bmo-miR-13b-5p

Accession MIMAT0015274
Previous IDsbmo-miR-13b*
Sequence

14 - 

ucguaaaaauggcugugucgug

 - 35

Get sequence
Deep sequencing45 reads, 3 experiments
Evidence experimental; Illumina [3]

Mature sequence bmo-miR-13b-3p

Accession MIMAT0007898
Previous IDsbmo-miR-13b
Sequence

48 - 

uaucacagccauuuuugacgagu

 - 70

Get sequence
Deep sequencing479 reads, 3 experiments
Evidence experimental; Northern [1], cloned [2], Illumina [3]
Database links

References

1
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
2
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
3
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).