Stem-loop sequence bmo-mir-13a

Accession MI0008341
Description Bombyx mori miR-13a stem-loop
Gene family MIPF0000049; mir-2
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-2_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-2 microRNA family includes the microRNA genes mir-2 and mir-13 (MIPF0000049). Mir-2 is widespread in invertebrates, and it is the largest family of microRNAs in the model species Drosophila melanogaster. MicroRNAs from this family are produced from the 3' arm of the precursor hairpin. Leaman et al. showed that the miR-2 family regulates cell survival by translational repression of proapoptotic factors. Based on computational prediction of targets, a role in neural development and maintenance has been suggested.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
gauaauc      c        c   g    a   ucucc 
       ucgauc ugucaaag ggc guga aug     u
       |||||| |||||||| ||| |||| |||      
       ggcugg guaguuuc ccg cacu uac     c
---auuu      u        a   a    a   uuucc 
Get sequence
Deep sequencing
109 reads, 3 experiments
Genome context
Coordinates (SILKDB2.0) Overlapping transcripts
nscaf1690: 7674236-7674314 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-13a
bmo-mir-2a-1 nscaf1690: 7674381-7674470 [-]
bmo-mir-13a nscaf1690: 7674236-7674314 [-]
bmo-mir-13b nscaf1690: 7674108-7674187 [-]
bmo-mir-2a-2 nscaf1690: 7673973-7674052 [-]
bmo-mir-2b nscaf1690: 7673850-7673925 [-]

Mature sequence bmo-miR-13a-5p

Accession MIMAT0007896
Previous IDs bmo-miR-13a*
Sequence

13 - 

ccugucaaagcggcggugaaa

 - 33

Get sequence
Evidence experimental; Northern [1]

Mature sequence bmo-miR-13a-3p

Accession MIMAT0007897
Previous IDs bmo-miR-13a
Sequence

50 - 

uaucacagccacuuugaugug

 - 70

Get sequence
Deep sequencing 109 reads, 3 experiments
Evidence experimental; Solexa [2]

References

1
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).