Stem-loop sequence bmo-mir-13a

AccessionMI0008341 (change log)
DescriptionBombyx mori miR-13a stem-loop
Gene family MIPF0000049; mir-2
Literature search

6 open access papers mention bmo-mir-13a
(23 sentences)

Stem-loop
   gauaauc      c        c   g    a   ucucc 
5'        ucgauc ugucaaag ggc guga aug     u
          |||||| |||||||| ||| |||| |||      
3'        ggcugg guaguuuc ccg cacu uac     c
   ---auuu      u        a   a    a   uuucc 
Get sequence
Deep sequencing
114 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582015.1: 7692416-7692494 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-13a
bmo-mir-2a-1NW_004582015.1: 7692561-7692650 [-]
bmo-mir-13aNW_004582015.1: 7692416-7692494 [-]
bmo-mir-13bNW_004582015.1: 7692288-7692367 [-]
bmo-mir-2a-2NW_004582015.1: 7692153-7692232 [-]
bmo-mir-2bNW_004582015.1: 7692030-7692105 [-]
Database links

Mature sequence bmo-miR-13a-5p

Accession MIMAT0007896
Previous IDsbmo-miR-13a*
Sequence

13 - 

ccugucaaagcggcggugaaa

 - 33

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Northern [1]

Mature sequence bmo-miR-13a-3p

Accession MIMAT0007897
Previous IDsbmo-miR-13a
Sequence

50 - 

uaucacagccacuuugaugug

 - 70

Get sequence
Deep sequencing112 reads, 3 experiments
Evidence experimental; Illumina [2]
Database links

References

1
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).