Stem-loop sequence bmo-mir-2b

AccessionMI0008340 (change log)
DescriptionBombyx mori miR-2b stem-loop
Gene family MIPF0000049; mir-2
Literature search

11 open access papers mention bmo-mir-2b
(38 sentences)

Stem-loop
   c   -              -         c    ggg u 
5'  gcu agaacucgacaagg ugguuguga augg   c c
    ||| |||||||||||||| ||||||||| ||||   |  
3'  cgg ucuugaguuguuuc accgacacu uacu   g a
   u   c              g         a    --a g 
Get sequence
Deep sequencing
1685 reads, 133 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582015.1: 7692030-7692105 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-2b
bmo-mir-2a-1NW_004582015.1: 7692561-7692650 [-]
bmo-mir-13aNW_004582015.1: 7692416-7692494 [-]
bmo-mir-13bNW_004582015.1: 7692288-7692367 [-]
bmo-mir-2a-2NW_004582015.1: 7692153-7692232 [-]
bmo-mir-2bNW_004582015.1: 7692030-7692105 [-]
Database links

Mature sequence bmo-miR-2b-5p

Accession MIMAT0015273
Previous IDsbmo-miR-2b*
Sequence

10 - 

ucgacaaggugguugugacaug

 - 31

Get sequence
Deep sequencing74 reads, 3 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence bmo-miR-2b-3p

Accession MIMAT0007895
Previous IDsbmo-miR-2b
Sequence

46 - 

uaucacagccagcuuuguugagu

 - 68

Get sequence
Deep sequencing1611 reads, 3 experiments
Evidence experimental; Northern [1], Illumina [2]
Database links

References

1
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).