Stem-loop sequence bmo-mir-2a-2

AccessionMI0008339 (change log)
DescriptionBombyx mori miR-2a-2 stem-loop
Gene family MIPF0000049; mir-2
Literature search

11 open access papers mention bmo-mir-2a-2
(79 sentences)

Stem-loop
   aaugu           -     -       c     c   uuu 
5'      uucgucgcuca caaag ugguugu guaug guu   a
        ||||||||||| ||||| ||||||| ||||| |||    
3'      aaguagcgagu guuuc accgaca uauac cgg   c
   -----           a     g       c     -   uuu 
Get sequence
Deep sequencing
1685 reads, 133 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582015.1: 7692153-7692232 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-2a-2
bmo-mir-2a-1NW_004582015.1: 7692561-7692650 [-]
bmo-mir-13aNW_004582015.1: 7692416-7692494 [-]
bmo-mir-13bNW_004582015.1: 7692288-7692367 [-]
bmo-mir-2a-2NW_004582015.1: 7692153-7692232 [-]
bmo-mir-2bNW_004582015.1: 7692030-7692105 [-]
Database links

Mature sequence bmo-miR-2a-2-5p

Accession MIMAT0015272
Previous IDsbmo-miR-2a-2*
Sequence

13 - 

cucacaaagugguugucguaug

 - 34

Get sequence
Deep sequencing30 reads, 3 experiments
Evidence experimental; Illumina [3]

Mature sequence bmo-miR-2a-3p

Accession MIMAT0007894
Previous IDsbmo-miR-2a
Sequence

52 - 

uaucacagccagcuuugaugagc

 - 74

Get sequence
Deep sequencing3311 reads, 3 experiments
Evidence experimental; Northern [1], RT-PCR [2], Illumina [3]
Database links

References

1
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
2
3
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).