Stem-loop sequence hsa-mir-1913

Accession

MI0008334

Symbol

HGNC:MIR1913

Description

Homo sapiens miR-1913 stem-loop

Gene family

MIPF0001015; mir-1913

Stem-loop

   -u    cucc      a     cu      -gc   c 
acc  cuac    cggcag ggagg  gcagag   ugg u
|||  ||||    |||||| |||||  ||||||   |||  
ugg  ggug    gucguc ccucc  cgucuc   acc u
   uc    aacc      g     cc      aaa   u 

Deep sequencing

12 reads, 7 experiments

Genome context

• Coordinates (GRCh37.p5): chr6: 166922842-166922921 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000043076 ; RPS6KA2-002; intron 1

  OTTHUMT00000043076 ; RPS6KA2-002; intron 1

  OTTHUMT00000043076 ; RPS6KA2-002; intron 1

  OTTHUMT00000043075 ; RPS6KA2-001; intron 4

  OTTHUMT00000362837 ; RPS6KA2-006; intron 4

  OTTHUMT00000362838 ; RPS6KA2-007; intron 4

  OTTHUMT00000362911 ; RPS6KA2-013; intron 4

  OTTHUMT00000362908 ; RPS6KA2-010; intron 4

  OTTHUMT00000362909 ; RPS6KA2-011; intron 4

  OTTHUMT00000043075 ; RPS6KA2-001; intron 4

  OTTHUMT00000362837 ; RPS6KA2-006; intron 4

  OTTHUMT00000362838 ; RPS6KA2-007; intron 4

  OTTHUMT00000362911 ; RPS6KA2-013; intron 4

  OTTHUMT00000362908 ; RPS6KA2-010; intron 4

  OTTHUMT00000362909 ; RPS6KA2-011; intron 4

  OTTHUMT00000043075 ; RPS6KA2-001; intron 4

  OTTHUMT00000362837 ; RPS6KA2-006; intron 4

  OTTHUMT00000362838 ; RPS6KA2-007; intron 4

  OTTHUMT00000362911 ; RPS6KA2-013; intron 4

  OTTHUMT00000362908 ; RPS6KA2-010; intron 4

  OTTHUMT00000362909 ; RPS6KA2-011; intron 4

  OTTHUMT00000043077 ; RPS6KA2-003; intron 5

  OTTHUMT00000043077 ; RPS6KA2-003; intron 5

  OTTHUMT00000043077 ; RPS6KA2-003; intron 5

  OTTHUMT00000362836 ; RPS6KA2-005; intron 6

  OTTHUMT00000362836 ; RPS6KA2-005; intron 6

  OTTHUMT00000362836 ; RPS6KA2-005; intron 6

  OTTHUMT00000362907 ; RPS6KA2-009; intron 7

  OTTHUMT00000362907 ; RPS6KA2-009; intron 7

  OTTHUMT00000362907 ; RPS6KA2-009; intron 7

  ENST00000366865 ; RPS6KA2-002; intron 1

  ENST00000366865 ; RPS6KA2-002; intron 1

  ENST00000366865 ; RPS6KA2-002; intron 1

  ENST00000265678 ; RPS6KA2-001; intron 4

  ENST00000481261 ; RPS6KA2-006; intron 4

  ENST00000405189 ; RPS6KA2-007; intron 4

  ENST00000507350 ; RPS6KA2-013; intron 4

  ENST00000512860 ; RPS6KA2-010; intron 4

  ENST00000507371 ; RPS6KA2-011; intron 4

  ENST00000366863 ; RPS6KA2-201; intron 4

  ENST00000265678 ; RPS6KA2-001; intron 4

  ENST00000481261 ; RPS6KA2-006; intron 4

  ENST00000405189 ; RPS6KA2-007; intron 4

  ENST00000507350 ; RPS6KA2-013; intron 4

  ENST00000512860 ; RPS6KA2-010; intron 4

  ENST00000507371 ; RPS6KA2-011; intron 4

  ENST00000366863 ; RPS6KA2-201; intron 4

  ENST00000265678 ; RPS6KA2-001; intron 4

  ENST00000481261 ; RPS6KA2-006; intron 4

  ENST00000405189 ; RPS6KA2-007; intron 4

  ENST00000507350 ; RPS6KA2-013; intron 4

  ENST00000512860 ; RPS6KA2-010; intron 4

  ENST00000507371 ; RPS6KA2-011; intron 4

  ENST00000366863 ; RPS6KA2-201; intron 4

  ENST00000503859 ; RPS6KA2-003; intron 5

  ENST00000503859 ; RPS6KA2-003; intron 5

  ENST00000503859 ; RPS6KA2-003; intron 5

  ENST00000510118 ; RPS6KA2-005; intron 6

  ENST00000510118 ; RPS6KA2-005; intron 6

  ENST00000510118 ; RPS6KA2-005; intron 6

  ENST00000506565 ; RPS6KA2-009; intron 7

  ENST00000506565 ; RPS6KA2-009; intron 7

  ENST00000506565 ; RPS6KA2-009; intron 7

Database links

• ENTREZGENE: 100302141;MIR1913
• HGNC: 35397;MIR1913

Mature sequence hsa-miR-1913

• Accession: MIMAT0007888
• Sequence: 49 - ucugcccccuccgcugcugcca - 70
• Deep sequencing: 10 reads, 6 experiments
• Evidence: experimental; 454 [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-1913
  • MICRORNA.ORG:hsa-miR-1913
  • MIRDB:hsa-miR-1913
  • RNA22-HSA:hsa-miR-1913
  • TARGETMINER:hsa-miR-1913

References

1. PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).