Stem-loop sequence hsa-mir-1908

Accession

MI0008329

Symbol

HGNC:MIR1908

Description

Homo sapiens miR-1908 stem-loop

Gene family

MIPF0001021; mir-1908

Stem-loop

----    aau    c       a     au    cc    g 
    cggg   gccg ggcgggg cggcg  uggu  guau u
    ||||   |||| ||||||| |||||  ||||  |||| g
    gccc   cggc ccgccuc gccgc  gcca  cgug u
cccc    --c    c       g     cg    -c    g 

Deep sequencing

148 reads, 14 experiments

Genome context

• Coordinates (GRCh37.p5): chr11: 61582633-61582712 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000347648 ; FADS1-001; intron 1

  OTTHUMT00000347649 ; FADS1-002; intron 1

  OTTHUMT00000398584 ; FADS1-012; 5'UTR (exon 1)

  OTTHUMT00000347655 ; FADS1-008; intron 1

  OTTHUMT00000398587 ; FADS1-016; intron 1

  OTTHUMT00000347652 ; FADS1-005; intron 1

  OTTHUMT00000347654 ; FADS1-007; intron 1

  OTTHUMT00000398590 ; FADS1-017; intron 1

  OTTHUMT00000347656 ; FADS1-009; intron 1

  OTTHUMT00000398591 ; FADS1-014; intron 1

  OTTHUMT00000347657 ; FADS1-010; intron 1

  OTTHUMT00000347648 ; FADS1-001; intron 1

  OTTHUMT00000347649 ; FADS1-002; intron 1

  OTTHUMT00000398584 ; FADS1-012; 5'UTR (exon 1)

  OTTHUMT00000347655 ; FADS1-008; intron 1

  OTTHUMT00000398587 ; FADS1-016; intron 1

  OTTHUMT00000347652 ; FADS1-005; intron 1

  OTTHUMT00000347654 ; FADS1-007; intron 1

  OTTHUMT00000398590 ; FADS1-017; intron 1

  OTTHUMT00000347656 ; FADS1-009; intron 1

  OTTHUMT00000398591 ; FADS1-014; intron 1

  OTTHUMT00000347657 ; FADS1-010; intron 1

  OTTHUMT00000347648 ; FADS1-001; intron 1

  OTTHUMT00000347649 ; FADS1-002; intron 1

  OTTHUMT00000398584 ; FADS1-012; 5'UTR (exon 1)

  OTTHUMT00000347655 ; FADS1-008; intron 1

  OTTHUMT00000398587 ; FADS1-016; intron 1

  OTTHUMT00000347652 ; FADS1-005; intron 1

  OTTHUMT00000347654 ; FADS1-007; intron 1

  OTTHUMT00000398590 ; FADS1-017; intron 1

  OTTHUMT00000347656 ; FADS1-009; intron 1

  OTTHUMT00000398591 ; FADS1-014; intron 1

  OTTHUMT00000347657 ; FADS1-010; intron 1

  OTTHUMT00000347653 ; FADS1-006; intron 2

  OTTHUMT00000398593 ; FADS1-015; exon 2

  OTTHUMT00000347653 ; FADS1-006; intron 2

  OTTHUMT00000398593 ; FADS1-015; exon 2

  OTTHUMT00000347653 ; FADS1-006; intron 2

  OTTHUMT00000398593 ; FADS1-015; exon 2

  ENST00000350997 ; FADS1-001; intron 1

  ENST00000433932 ; FADS1-002; intron 1

  ENST00000542506 ; FADS1-012; 5'UTR (exon 1)

  ENST00000424501 ; FADS1-008; intron 1

  ENST00000540767 ; FADS1-016; intron 1

  ENST00000421879 ; FADS1-005; intron 1

  ENST00000491310 ; FADS1-007; intron 1

  ENST00000544696 ; FADS1-017; intron 1

  ENST00000466716 ; FADS1-009; intron 1

  ENST00000544309 ; FADS1-014; intron 1

  ENST00000473263 ; FADS1-010; intron 1

  ENST00000350997 ; FADS1-001; intron 1

  ENST00000433932 ; FADS1-002; intron 1

  ENST00000542506 ; FADS1-012; 5'UTR (exon 1)

  ENST00000424501 ; FADS1-008; intron 1

  ENST00000540767 ; FADS1-016; intron 1

  ENST00000421879 ; FADS1-005; intron 1

  ENST00000491310 ; FADS1-007; intron 1

  ENST00000544696 ; FADS1-017; intron 1

  ENST00000466716 ; FADS1-009; intron 1

  ENST00000544309 ; FADS1-014; intron 1

  ENST00000473263 ; FADS1-010; intron 1

  ENST00000350997 ; FADS1-001; intron 1

  ENST00000433932 ; FADS1-002; intron 1

  ENST00000542506 ; FADS1-012; 5'UTR (exon 1)

  ENST00000424501 ; FADS1-008; intron 1

  ENST00000540767 ; FADS1-016; intron 1

  ENST00000421879 ; FADS1-005; intron 1

  ENST00000491310 ; FADS1-007; intron 1

  ENST00000544696 ; FADS1-017; intron 1

  ENST00000466716 ; FADS1-009; intron 1

  ENST00000544309 ; FADS1-014; intron 1

  ENST00000473263 ; FADS1-010; intron 1

  ENST00000448607 ; FADS1-006; intron 2

  ENST00000541683 ; FADS1-015; exon 2

  ENST00000543488 ; FADS1-202; intron 2

  ENST00000448607 ; FADS1-006; intron 2

  ENST00000541683 ; FADS1-015; exon 2

  ENST00000543488 ; FADS1-202; intron 2

  ENST00000448607 ; FADS1-006; intron 2

  ENST00000541683 ; FADS1-015; exon 2

  antisense

  OTTHUMT00000439313 ; FADS2-015; intron 1

  OTTHUMT00000439313 ; FADS2-015; intron 1

  ENST00000574708 ; FADS2-015; intron 1

  ENST00000574708 ; FADS2-015; intron 1

Database links

• ENTREZGENE: 100302263;MIR1908
• HGNC: 35392;MIR1908

Mature sequence hsa-miR-1908

• Accession: MIMAT0007881
• Sequence: 12 - cggcggggacggcgauugguc - 32
• Deep sequencing: 143 reads, 13 experiments
• Evidence: experimental; 454 [1-2], Solexa [3]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-1908
  • MICRORNA.ORG:hsa-miR-1908
  • MIRDB:hsa-miR-1908
  • RNA22-HSA:hsa-miR-1908
  • TARGETMINER:hsa-miR-1908

References

1. PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2. PMID:19508715 "Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing" Nygaard S, Jacobsen A, Lindow M, Eriksen J, Balslev E, Flyger H, Tolstrup N, Moller S, Krogh A, Litman T BMC Med Genomics. 2:35(2009).
3. PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).