Stem-loop sequence mmu-mir-1904

AccessionMI0008323 (change log)
Symbol MGI:Mir1904
DescriptionMus musculus miR-1904 stem-loop
Literature search

2 open access papers mention mmu-mir-1904
(22 sentences)

Stem-loop
   --     u  c   ----     uccu            ucc  u 
5'   caagu ag ugu    ucugc    cuggagggaggu   ug u
     ||||| || |||    |||||    ||||||||||||   ||  
3'   guuua uu aca    agaug    gacuucucucca   ac u
   ac     u  u   aauu     ----            --c  g 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr13: 109903809-109903888 [+]
sense
OTTMUST00000080741 ; Pde4d-011; intron 1
OTTMUST00000080776 ; Pde4d-012; intron 2
OTTMUST00000080693 ; Pde4d-003; intron 6
OTTMUST00000080695 ; Pde4d-005; intron 6
OTTMUST00000080737 ; Pde4d-007; intron 6
OTTMUST00000097714 ; Pde4d-019; intron 6
OTTMUST00000080738 ; Pde4d-008; intron 6
OTTMUST00000080739 ; Pde4d-009; intron 6
OTTMUST00000079296 ; Pde4d-001; intron 8
ENSMUST00000120664 ; Pde4d-011; intron 1
ENSMUST00000119672 ; Pde4d-012; intron 2
ENSMUST00000120671 ; Pde4d-003; intron 6
ENSMUST00000153234 ; Pde4d-005; intron 6
ENSMUST00000119507 ; Pde4d-007; intron 6
ENSMUST00000079975 ; Pde4d-019; intron 6
ENSMUST00000135275 ; Pde4d-008; intron 6
ENSMUST00000074103 ; Pde4d-009; intron 6
ENSMUST00000177907 ; Pde4d-201; intron 7
ENSMUST00000122041 ; Pde4d-001; intron 8
Database links

Mature sequence mmu-miR-1904

Accession MIMAT0007874
Sequence

11 - 

guucugcuccucuggagggagg

 - 32

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; microarray [1], PCR [1]
Predicted targets

References

1
PMID:18492288 "MicroRNA-encoding long non-coding RNAs" He S, Su H, Liu C, Skogerbo G, He H, He D, Zhu X, Liu T, Zhao Y, Chen R BMC Genomics. 9:236(2008).