Stem-loop sequence mmu-mir-1906-1

AccessionMI0008321 (change log)
Previous IDsmmu-mir-1906
Symbol MGI:Mir1906-1
DescriptionMus musculus miR-1906-1 stem-loop
Gene family MIPF0001001; mir-1906
Literature search

2 open access papers mention mmu-mir-1906-1
(2 sentences)

Stem-loop
   ----------------------------------------------------g   a       c 
5'                                                      gac uuaggag a
                                                        ||| |||||||  
3'                                                      uug gauccuc a
   ccagagacgggucgggacggaguccgacgacgucaaguaaauuaagaguguug   g       c 
Get sequence
Deep sequencing
78 reads, 0 reads per million, 29 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109544541-109544620 [+]
sense
OTTMUST00000055476 ; Meg3-008; exon 1
OTTMUST00000055472 ; Meg3-004; exon 2
OTTMUST00000055473 ; Meg3-005; exon 3
OTTMUST00000055471 ; Meg3-003; exon 3
OTTMUST00000055470 ; Meg3-002; exon 3
ENSMUST00000126289 ; Meg3-008; exon 1
ENSMUST00000143272 ; Meg3-004; exon 2
ENSMUST00000129245 ; Meg3-005; exon 3
ENSMUST00000143836 ; Meg3-003; exon 3
ENSMUST00000124106 ; Meg3-002; exon 3
Database links

Mature sequence mmu-miR-1906

Accession MIMAT0007872
Sequence

48 - 

ugcagcagccugaggcagggcu

 - 69

Get sequence
Deep sequencing20 reads, 9 experiments
Evidence experimental; microarray [1], PCR [1]
Predicted targets

References

1
PMID:18492288 "MicroRNA-encoding long non-coding RNAs" He S, Su H, Liu C, Skogerbo G, He H, He D, Zhu X, Liu T, Zhao Y, Chen R BMC Genomics. 9:236(2008).