Stem-loop sequence mmu-mir-1895

AccessionMI0008316 (change log)
Symbol MGI:Mir1895
DescriptionMus musculus miR-1895 stem-loop
Literature search

3 open access papers mention mmu-mir-1895
(3 sentences)

Stem-loop
   ----c  aca          -          cc  -        
5'      cc   ccuuuuccuc uucuucuugg  gg guuggcu 
        ||   |||||||||| ||||||||||  || |||||| c
3'      gg   ggaggaggag aggaggagcc  cc cgaccgc 
   aguaa  --a          c          cc  u        
Get sequence
Deep sequencing
13125 reads, 84.9 reads per million, 93 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 134240505-134240583 [-]
sense
ENSMUST00000180471 ; Gm26691-201; exon 1
antisense
OTTMUST00000112194 ; Cxxc4-001; 3'UTR (exon 3)
ENSMUST00000181904 ; Cxxc4-001; 3'UTR (exon 3)
ENSMUST00000053048 ; Cxxc4-201; 3'UTR (exon 3)
ENSMUST00000166288 ; Cxxc4-202; 3'UTR (exon 3)
Database links

Mature sequence mmu-miR-1895

Accession MIMAT0007867
Sequence

48 - 

cccccgaggaggacgaggagga

 - 69

Get sequence
Deep sequencing11639 reads, 89 experiments
Evidence experimental; microarray [1], PCR [1]
Predicted targets

References

1
PMID:18492288 "MicroRNA-encoding long non-coding RNAs" He S, Su H, Liu C, Skogerbo G, He H, He D, Zhu X, Liu T, Zhao Y, Chen R BMC Genomics. 9:236(2008).