Stem-loop sequence mmu-mir-1902

AccessionMI0008313 (change log)
Symbol MGI:Mir1902
DescriptionMus musculus miR-1902 stem-loop
Gene family MIPF0000791; mir-1902
Literature search

5 open access papers mention mmu-mir-1902
(30 sentences)

Stem-loop
   --        u  ga             aa      uuga 
5'   guuuauuu gg  guguuugcuguau  uuggac    u
     |||||||| ||  |||||||||||||  ||||||     
3'   uagaugag uc  uacggaugacgug  gauuug    a
   aa        u  ag             ga      uaaa 
Get sequence
Deep sequencing
32 reads, 0 reads per million, 20 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 104428861-104428940 [-]
sense
OTTMUST00000035479 ; Hipk3-001; 3'UTR (exon 16)
ENSMUST00000028600 ; Hipk3-001; 3'UTR (exon 16)
Database links

Mature sequence mmu-miR-1902

Accession MIMAT0007863
Sequence

49 - 

agaggugcaguaggcaugacuu

 - 70

Get sequence
Deep sequencing19 reads, 12 experiments
Evidence experimental; microarray [1], PCR [1]
Database links
Predicted targets

References

1
PMID:18492288 "MicroRNA-encoding long non-coding RNAs" He S, Su H, Liu C, Skogerbo G, He H, He D, Zhu X, Liu T, Zhao Y, Chen R BMC Genomics. 9:236(2008).