Stem-loop sequence aga-mir-1891

AccessionMI0008312 (change log)
DescriptionAnopheles gambiae miR-1891 stem-loop
Gene family MIPF0000857; mir-1891
Literature search

2 open access papers mention aga-mir-1891
(4 sentences)

Stem-loop
   ---  c  cu     u         uga         uu        uuaua 
5'    gc uc  cuuuu ccgucaugu   ggaguuaau  gcguguuu     u
      || ||  ||||| |||||||||   |||||||||  ||||||||      
3'    cg ag  gaaaa gguaguaca   ucucaauua  ugcacaaa     u
   caa  -  -c     u         ugg         cc        uuagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This mature miRNA was cloned from Anopheles stepheni, and mapped to the A. gambiae genome [1].

Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr3R: 5819038-5819138 [-]
intergenic
Database links

Mature sequence aga-miR-1891

Accession MIMAT0007862
Sequence

23 - 

ugaggaguuaauuugcguguuuu

 - 45

Get sequence
Evidence not experimental

References

1