Stem-loop sequence aga-mir-1890

AccessionMI0008311 (change log)
DescriptionAnopheles gambiae miR-1890 stem-loop
Gene family MIPF0000848; mir-1890
Literature search

2 open access papers mention aga-mir-1890
(5 sentences)

Stem-loop
         -    cg      g     ug   u     u    gaauauu 
5' gucgug ugga  gccaga cuaau  gag auuuc ugag       u
   |||||| ||||  |||||| |||||  ||| ||||| ||||        
3' cagcau gcuu  uggucu gauua  uuc uaaag acuc       u
         u    au      g     gu   -     u    gaacagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This mature miRNA was cloned from Anopheles stepheni, and mapped to the A. gambiae genome [1].

Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr3R: 21181082-21181177 [-]
intergenic
Database links

Mature sequence aga-miR-1890

Accession MIMAT0007861
Sequence

61 - 

ugaaaucuuugauuaggucu

 - 80

Get sequence
Evidence not experimental

References

1