Stem-loop sequence aga-mir-1889

AccessionMI0008309 (change log)
DescriptionAnopheles gambiae miR-1889 stem-loop
Literature search

3 open access papers mention aga-mir-1889
(9 sentences)

Stem-loop
   u ug           c gc        a       a      caccg  aa   c    c   u   c 
5'  g  gcguggauggg g  aaucucaa uuguaau gugugu     uu  cgg ugga cau gug u
    |  ||||||||||| |  |||||||| ||||||| ||||||     ||  ||| |||| ||| |||  
3'  c  cguaccugccc c  uuaggguu gacauua cacaca     aa  gcc accu gug uac g
   g cu           - -a        a       -      ---aa  ga   -    a   c   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This mature miRNA was cloned from Anopheles stepheni, and mapped to the A. gambiae genome [1].

Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr2R: 37888789-37888919 [-]
intergenic
Clustered miRNAs
< 10kb from aga-mir-1889
aga-mir-283chr2R: 37890034-37890125 [-]
aga-mir-1889chr2R: 37888789-37888919 [-]
aga-mir-12chr2R: 37888037-37888153 [-]
Database links

Mature sequence aga-miR-1889

Accession MIMAT0007859
Sequence

95 - 

acacauuacagauugggauua

 - 115

Get sequence
Evidence not experimental

References

1