Stem-loop sequence ath-MIR1888a

AccessionMI0008305 (change log)
Previous IDsath-MIR1888
DescriptionArabidopsis thaliana miR1888 stem-loop
Gene family MIPF0001333; MIR1888
Literature search

1 open access papers mention ath-MIR1888a
(1 sentences)

Stem-loop
            ua                       c  uu       ag u 
5' ccaaauuuu  aguuaagauuugugaagaaagag uu  auauaag  u u
   |||||||||  ||||||||||||||||||||||| ||  |||||||  |  
3' gguuuagaa  ucgauucuaaauacuucuuuuuu aa  uauauuc  a u
            --                       a  uu       gg u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 7168870-7168969 [+]
intergenic
Database links

Mature sequence ath-miR1888a

Accession MIMAT0007855
Previous IDsath-miR1888
Sequence

10 - 

uaaguuaagauuugugaagaa

 - 30

Get sequence
Evidence experimental; PARE [1], Illumina [2]

References

1
PMID:18542052 "Global identification of microRNA-target RNA pairs by parallel analysis of RNA ends" German MA, Pillay M, Jeong DH, Hetawal A, Luo S, Janardhanan P, Kannan V, Rymarquis LA, Nobuta K, German R, De Paoli E, Lu C, Schroth G, Meyers BC, Green PJ Nat Biotechnol. 26:941-946(2008).
2
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).