Stem-loop sequence bra-MIR1885a

AccessionMI0008302 (change log)
Previous IDsbra-MIR1885
DescriptionBrassica rapa miR1885a stem-loop
Gene family MIPF0001505; MIR1885
Literature search

6 open access papers mention bra-MIR1885a
(12 sentences)

Stem-loop
   cau   -  c    c        u -u            c    u      a       c   -uaaaaaa          a          -          aau  a          agaaugauacugagcucuuacauucgauuagaugcgauaauc 
5'    ccu gu uuca gagcuucc c  agaagaugugcg agag cuuucu agucaca uca        uucaaagaaa ggaaucauac uuucauugau   ga aucaauagag                                          u
      ||| || |||| |||||||| |  |||||||||||| |||| |||||| ||||||| |||        |||||||||| |||||||||| ||||||||||   || ||||||||||                                           
3'    gga ca aagu cucgaagg g  ucuucuacaugc ucuc gaaaga ucagugu agu        aaguuucuuu ccuuaguaug aaaguaacua   cu uaguuaucuc                                          u
   gau   a  a    a        c cc            a    c      a       a   uuucacua          c          g          cuu  c          cuacuagguaaccaguagucgagaauguucguuaaucuccua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA6: 25298379-25298698 [+]
intergenic
Database links

Mature sequence bra-miR1885a

Accession MIMAT0009213
Previous IDsbra-miR1885
Sequence

217 - 

caucaaugaaagguaugauucc

 - 238

Get sequence
Evidence experimental; cloned [1], Northern [1], Illumina [2]

References

1
2
PMID:22025521 "Identification of conserved and novel microRNAs that are responsive to heat stress in Brassica rapa" Yu X, Wang H, Lu Y, de Ruiter M, Cariaso M, Prins M, van Tunen A, He Y J Exp Bot. 63:1025-1038(2012).