Stem-loop sequence osa-MIR1883b

AccessionMI0008301 (change log)
DescriptionOryza sativa miR1883b stem-loop
Gene family MIPF0000683; MIR1883
Stem-loop
   --c      a                             c    c a   -       c u      aa 
5'    gguugc gcccgucacagguaucuagucaccuguga gggc g gaa uggaauc g caaagg  c
      |||||| ||||||||||||||||||||||||||||| |||| | ||| ||||||| | ||||||   
3'    ucaacg cgggcaguguccauagaucaguggacacu cccg c cuu aucuuag c guuucc  a
   cau      c                             a    u -   c       a u      ac 
Get sequence
Deep sequencing
246 reads, 0 reads per million, 2 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 9367993-9368128 [-]
intergenic
Database links

Mature sequence osa-miR1883b

Accession MIMAT0007852
Sequence

30 - 

accugugacgggccgagaauggaa

 - 53

Get sequence
Deep sequencing128 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).