Stem-loop sequence osa-MIR1883a

AccessionMI0008300 (change log)
DescriptionOryza sativa miR1883a stem-loop
Gene family MIPF0000683; MIR1883
Literature search

4 open access papers mention osa-MIR1883a
(4 sentences)

Stem-loop
   --ac       u                      gc                  a   g 
5'     ccgucac gguaucuagucaccugugacgg  cgagaauggaacccguca agg a
       ||||||| ||||||||||||||||||||||  |||||||||||||||||| |||  
3'     ggcagug ccguagaucaguggacacugcc  gcucuuaccuugggcagu ucc c
   gccc       u                      ua                  c   a 
Get sequence
Deep sequencing
295 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 13523520-13523637 [+]
intergenic
Database links

Mature sequence osa-miR1883a

Accession MIMAT0007851
Sequence

22 - 

accugugacgggccgagaauggaa

 - 45

Get sequence
Deep sequencing128 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).