Stem-loop sequence osa-MIR812j

AccessionMI0008299 (change log)
DescriptionOryza sativa miR812j stem-loop
Gene family MIPF0000345; MIR812
Literature search

10 open access papers mention osa-MIR812j
(17 sentences)

Stem-loop
   aga u   ---   ------        --g         uc       c                          u              ug            --       uuu   aaaaacuaaaaaacacaagucacgcauaaacuacu 
5'    g gca   ucc      uuggucuu   gauaguacu  cuuuguc caaaauaagcguagccaugaguuuuc uguccaacuuuaau  uucgucuuauuu  aauuuuu   uga                                   a
      | |||   |||      ||||||||   |||||||||  ||||||| |||||||||||||||||||||||||| ||||||||||||||  ||||||||||||  |||||||   |||                                   u
3'    c cgu   agg      gacuagaa   uuaucauga  gaggcag guuuuauuugcgucgguacucaaagg acagguugaaauua  aggcagaauaaa  uuaaaaa   acu                                   u
   --a -   aaa   uugauc        agg         ga       u                          c              gu            cu       cau   aaucauaaaaauaacaauaaucuaauauuuuguac 
Get sequence
Deep sequencing
4356 reads, 600 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 19806333-19806629 [+]
intergenic
Database links

Mature sequence osa-miR812j

Accession MIMAT0007850
Sequence

200 - 

aagacggaugauuaaaguuggaca

 - 223

Get sequence
Deep sequencing2494 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).