Stem-loop sequence osa-MIR812i

AccessionMI0008298 (change log)
DescriptionOryza sativa miR812i stem-loop
Gene family MIPF0000345; MIR812
Literature search

10 open access papers mention osa-MIR812i
(17 sentences)

Stem-loop
   --ua a        ca   a               aua         c        a                  aaacuuuuuuaugauuaguauuuuuuuauuagauuguaaaacauga 
5'     g acucccuc  ucc aaaauaagcguagcc   aguuuucgu uucaacuu gaucaucugucuuauuug                                              a
       | ||||||||  ||| |||||||||||||||   ||||||||| |||||||| ||||||||||||||||||                                               
3'     c ugagggag  agg uuuuauucgcgucgg   ucaaaagca agguugaa uuaguaggcagaauaaau                                              u
   gagg a        ua   g               gac         c        a                  aaaaaaaaucuuuuagauuuuauuauauucaguacguauuucauua 
Get sequence
Deep sequencing
2388 reads, 300 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr7: 22152329-22152570 [+]
intergenic
Database links

Mature sequence osa-miR812i

Accession MIMAT0007849
Sequence

173 - 

aagacggaugauuaaaguuggaca

 - 196

Get sequence
Deep sequencing2107 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).