Stem-loop sequence osa-MIR812h

AccessionMI0008297 (change log)
DescriptionOryza sativa miR812h stem-loop
Gene family MIPF0000345; MIR812
Literature search

10 open access papers mention osa-MIR812h
(16 sentences)

Stem-loop
   uu    u        cc    u      c au         -  --c                            cu        -------      u 
5'   guac cccuccgu  cauu uaagug a  caugaguuu cg   ccaacuuuaaucaucuguuuuauuugaa  uuuuauaa       auagua u
     |||| ||||||||  |||| |||||| |  ||||||||| ||   ||||||||||||||||||||||||||||  ||||||||       ||||||  
3'   caug gggaggua  guaa auucac u  guacucaaa gc   gguugaaauuaguaggcagaauaaauuu  aaaauauu       uguuau u
   au    -        aa    c      a cg         a  aca                            --        agaguau      u 
Get sequence
Deep sequencing
2665 reads, 300 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 1164921-1165107 [-]
intergenic
Database links

Mature sequence osa-miR812h

Accession MIMAT0007848
Sequence

121 - 

aagacggaugauuaaaguuggaca

 - 144

Get sequence
Deep sequencing2307 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).