Stem-loop sequence osa-MIR812g

AccessionMI0008296 (change log)
DescriptionOryza sativa miR812g stem-loop
Gene family MIPF0000345; MIR812
Literature search

11 open access papers mention osa-MIR812g
(19 sentences)

Stem-loop
   uucc    uaa     c                    c   -     a  c cu                           aaaaauuaaaaacauaagucaugaguaaaguauacuauuca 
5'     gaug   ucccu uguuccauuuuaagugcagc aug guuuu cg g  caacuuuaaucguccgucuuauuuaaa                                         u
       ||||   ||||| |||||||||||||||||||| ||| ||||| || |  |||||||||||||||||||||||||||                                         a
3'     cuau   aggga gcaggguaaaauucauguug uac caaag gu c  guugaaauuaguaggcagaauaaauuu                                         u
   -uua    --g     a                    a   u     -  a ag                           aaaaaaauauuaaucauaaaaauaacaauacucuauuauuu 
Get sequence
Deep sequencing
3078 reads, 300 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 5230013-5230254 [+]
intergenic
Database links

Mature sequence osa-miR812g

Accession MIMAT0007847
Sequence

173 - 

aagacggaugauuaaaguuggaca

 - 196

Get sequence
Deep sequencing2192 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).