Stem-loop sequence osa-MIR1882e

AccessionMI0008292 (change log)
DescriptionOryza sativa miR1882e stem-loop
Gene family MIPF0000571; MIR1882
Literature search

2 open access papers mention osa-MIR1882e
(2 sentences)

Stem-loop
   --c   ua           u              uuu         -c         a  u     u   a 
5'    caa  uccuagauugc uucaaggucauuuc   agggaaccc  auucccaua au cagua cca a
      |||  ||||||||||| ||||||||||||||   |||||||||  ||||||||| || ||||| |||  
3'    guu  aggaucuaaug agguucuaguaaag   ucccuuggg  uaaggguau ua gucgu ggu g
   guc   ug           c              cau         aa         c  u     u   c 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr10: 10320904-10321044 [-]
intergenic
Database links

Mature sequence osa-miR1882e-5p

Accession MIMAT0007843
Sequence

11 - 

agauugcuuucaaggucauuucuu

 - 34

Get sequence
Evidence experimental; 454 [1], Illumina [2]

Mature sequence osa-miR1882e-3p

Accession MIMAT0015285
Sequence

108 - 

gaaaugaucuuggacguaaucuag

 - 131

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [2]

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).
2
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).