Stem-loop sequence osa-MIR1879

AccessionMI0008285 (change log)
DescriptionOryza sativa miR1879 stem-loop
Literature search

2 open access papers mention osa-MIR1879
(4 sentences)

Stem-loop
   ---u  -                    c            --   acgcaaauggcuuguugaggaauaaacaucuu 
5'     cc aacccaucccaccucguccc aaaccaaacaca  ugc                                g
       || |||||||||||||||||||| ||||||||||||  |||                                 
3'     gg uuggguaggguggaguaggg uuugguuugugu  acg                                c
   accu  a                    a            au   aacuucuuauaguaucaaaucuuacguucccu 
Get sequence
Deep sequencing
287 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr10: 5635320-5635469 [+]
intergenic
Database links

Mature sequence osa-miR1879

Accession MIMAT0007836
Sequence

112 - 

guguuugguuuagggaugaggugg

 - 135

Get sequence
Deep sequencing283 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).