Stem-loop sequence osa-MIR1878

AccessionMI0008284 (change log)
DescriptionOryza sativa miR1878 stem-loop
Gene family MIPF0001218; MIR1878
Literature search

1 open access papers mention osa-MIR1878
(3 sentences)

Stem-loop
   --    cug -                       agaaaau  u      g 
5'   acca   c agacuuaaucuggacacuauaaa       ug gcaugu a
     ||||   | |||||||||||||||||||||||       || ||||||  
3'   uggu   g uuugaguuagacuugugauguuu       ac cguaua a
   gu    -aa a                       aaauauu  c      a 
Get sequence
Deep sequencing
66 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr9: 16555509-16555608 [+]
intergenic
Database links

Mature sequence osa-miR1878

Accession MIMAT0007835
Sequence

11 - 

acuuaaucuggacacuauaaaaga

 - 34

Get sequence
Deep sequencing49 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).