Stem-loop sequence osa-MIR1862e

AccessionMI0008282 (change log)
DescriptionOryza sativa miR1862e stem-loop
Gene family MIPF0000580; MIR1862
Literature search

12 open access papers mention osa-MIR1862e
(17 sentences)

Stem-loop
   --          a            a            uu     u 
5'   uauuuccuuc ucccaaaaugaa aaaucuaguaca  augug u
     |||||||||| |||||||||||| ||||||||||||  ||||| u
3'   augagggagg aggguuuuauuu uuuagaucaugu  uauac g
   cu          c            g            cc     a 
Get sequence
Deep sequencing
6445 reads, 3.4e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 2523232-2523324 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR1862e
osa-MIR1862eChr11: 2523232-2523324 [+]
osa-MIR2872Chr11: 2524994-2525353 [+]
Database links

Mature sequence osa-miR1862e

Accession MIMAT0007833
Sequence

60 - 

cuagauuuguuuauuuugggacgg

 - 83

Get sequence
Deep sequencing6285 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).