Stem-loop sequence osa-MIR1876

AccessionMI0008280 (change log)
DescriptionOryza sativa miR1876 stem-loop
Literature search

7 open access papers mention osa-MIR1876
(13 sentences)

Stem-loop
   ggca     guugg  uu    ug a       u    ug   uu                     c     g ua      
5'     cauau     ua  cuau  g augcaag gggc  gcu  ugaacccauuuaugggcuauu aagug g  aacca 
       |||||     ||  ||||  | ||||||| ||||  |||  ||||||||||||||||||||| ||||| |  |||| u
3'     guaug     au  gaua  c uauguuc cccg  cgg  guuugggugaauauccgguaa uucac u  uugga 
   -uua     -----  uu    gu c       u    gu   gu                     a     g gg      
Get sequence
Deep sequencing
257 reads, 150 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr10: 4833365-4833521 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR1876
osa-MIR1876Chr10: 4833365-4833521 [+]
osa-MIR1862dChr10: 4833611-4833760 [+]
Database links

Mature sequence osa-miR1876

Accession MIMAT0007831
Sequence

106 - 

auaaguggguuugugggcuggccc

 - 129

Get sequence
Deep sequencing254 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).