Stem-loop sequence osa-MIR1862d

AccessionMI0008279 (change log)
DescriptionOryza sativa miR1862d stem-loop
Gene family MIPF0000580; MIR1862
Literature search

15 open access papers mention osa-MIR1862d
(24 sentences)

Stem-loop
   cuac       ucuc     uu    -                             g           augu  c 
5'     uggcuag    guagc  gcua gguacucccucugucccaaaauaaacaaa cuaguacgggg    gg a
       |||||||    |||||  |||| ||||||||||||||||||||||||||||| |||||||||||    || c
3'     auugguc    cauug  ugau cuaugagggaggcaggguuuuauuuguuu gaucauguccu    cc u
   -auc       uccu     uu    a                             g           -gau  u 
Get sequence
Deep sequencing
6716 reads, 3.35e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr10: 4833611-4833760 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR1862d
osa-MIR1876Chr10: 4833365-4833521 [+]
osa-MIR1862dChr10: 4833611-4833760 [+]
Database links

Mature sequence osa-miR1862d

Accession MIMAT0007830
Sequence

90 - 

acuagguuuguuuauuuugggacg

 - 113

Get sequence
Deep sequencing6352 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).